|  Help  |  About  |  Contact Us

Allele : Echdc1<em1(IMPC)J> enoyl Coenzyme A hydratase domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6376198 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Echdc1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATTTAGGTAGAAAAAT and AGTTATAGTACTAAGCACAC, which resulted in a 458 bp deletion beginning at Chromosome 10 position 29,322,031 bp and ending after 29,322,488 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001307826 (exon 3) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 42 amino acids later. There is a 10 bp insertion (TTATAGTACT) at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Echdc1<->,
  • Echdc1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele