|  Help  |  About  |  Contact Us

Allele : 1700020N01Rik<em1(IMPC)J> RIKEN cDNA 1700020N01 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6376209 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  1700020N01Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTACAACACACTGCGGCA and GTAATCTAAGCTCGCTCCCG, which resulted in a 732 bp deletion beginning at Chromosome 10 position 21,593,062 bp and ending after 21,593,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365479 and ENSMUSE00000335433 (exons 1 and 2) and 401 bp of flanking intronic sequence including the start site and splice donor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories