| Primary Identifier | MGI:6376209 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 1700020N01Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTACAACACACTGCGGCA and GTAATCTAAGCTCGCTCCCG, which resulted in a 732 bp deletion beginning at Chromosome 10 position 21,593,062 bp and ending after 21,593,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000365479 and ENSMUSE00000335433 (exons 1 and 2) and 401 bp of flanking intronic sequence including the start site and splice donor and is predicted to generate a null allele. |
