| Primary Identifier | MGI:6376217 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Creg2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATTCATCTGAAAACGTGA and TATTCTGTCTGGAAGCTGAA, which resulted in a 575 bp deletion beginning at Chromosome 1 position 39,647,621 bp and ending after 39,648,195 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000356149 (exon 2) and 405 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 49 amino acids. |