| Primary Identifier | MGI:6376222 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc25a44 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTTACCACAAAGTCG AND GGTGAGGAATGATTTCAGAA, which resulted in a 1060 bp deletion beginning at Chromosome 3 position 88,420,282 bp and ending after 88,421,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980176 (exon 2) and 422 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 43 amino acids later. |
