| Primary Identifier | MGI:6376660 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Psma8 |
| Strain of Origin | (C57BL/6J x CBA/J)F2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 genome editing technology was used with two sgRNAs (targeting GGGCATACTCCACTTGGAAA and ACCGCGGTAAGCTGCTCCCC) to generate a 56 base pair deletion encompassing the last three nucleotides of the coding region of exon 1 and intronic sequence at the 5' end of intron 1 (GRCm39:chr18:14839387-14839442). The deletion of the exon/intron 1 splice donor site cause anomalous splicing of the truncated exon 1 to a cryptic exon in intron 1, followed by splicing to exon 2 and onward. |
