|  Help  |  About  |  Contact Us

Allele : Gm5127<em1(IMPC)J> predicted gene 5127; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6382549 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gm5127
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTGCGGAGGTCTTTCATA and GAAACTAACTATAATGGTCT, which resulted in a 629 bp deletion beginning at Chromosome X position 106,709,117 bp and ending after 106,709,745 bp (GRCm38/mm10). This mutation deletes 629 bp from ENSMUSE00000654025 (exon 4) and is predicted to cause a change of amino acid sequence at residue 1 followed by a stop.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories