| Primary Identifier | MGI:6382549 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm5127 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTGCGGAGGTCTTTCATA and GAAACTAACTATAATGGTCT, which resulted in a 629 bp deletion beginning at Chromosome X position 106,709,117 bp and ending after 106,709,745 bp (GRCm38/mm10). This mutation deletes 629 bp from ENSMUSE00000654025 (exon 4) and is predicted to cause a change of amino acid sequence at residue 1 followed by a stop. |