| Primary Identifier | MGI:6367581 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Psip1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTTATCTCCAAACATAGG and GAGTTCACTCAGGTGTACTA, which resulted in a 359 bp deletion beginning at Chromosome 4 position 83,482,211 bp and ending after 83,482,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000316636 (exon 3) and 282 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 14 amino acids later. |