| Primary Identifier | MGI:6379302 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cped1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAATCATCACACTCTTTAC and TTGGAACCACTGTATCTGTG, which resulted in a 260 bp deletion beginning at Chromosome 6 position 22,051,254 bp and ending after 22,051,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001312394 (exon 3) and 153 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later. There is a 2 bp TT insertion at the deletion site. |
