| Primary Identifier | MGI:6388628 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fancf |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCCACACTCAAGCACCACC and TTGCTGCACAAGCGGCTCCA, which resulted in a 1010 bp deletion beginning at Chromosome 7 position 51,861,249 bp and ending after 51,862,258 bp (GRCm38/mm10). This mutation deletes 1010 bp of ENSMUSE00000879688 (exon 1) including the start site and is predicted to generate a null allele. |
