|  Help  |  About  |  Contact Us

Allele : Slc17a1<em1(IMPC)J> solute carrier family 17 (sodium phosphate), member 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6384875 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc17a1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAAGGGACTTACTTCCAAA and TCGTGAGCTAGGTTCTACAG, which resulted in a 522 bp deletion beginning at Chromosome 13 position 23,874,305 bp and ending after 23,874,826 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000253347 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories