| Primary Identifier | MGI:6367818 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klhl34 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGAGGCATCCCATAACA and TAAGGAGGTGAACAAGGCCT, which resulted in a 1657 bp deletion beginning at Chromosome X position 157,818,351 bp and ending after 157,820,007 bp (GRCm38/mm10). This mutation deletes 1572 bp of ENSMUSE00000543784 (exon 1) and 83 bp upstream of the ATG start and is predicted to generate a null allele. There is a 6 bp insertion TCCAGC at the deletion site. |
