| Help | About | Contact Us

Allele : Cd38<em1(IMPC)Ccpcz> CD38 antigen; endonuclease-mediated mutation 1, Institute of Molecular Genetics

Primary Identifier	MGI:6385272	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Cd38
Inheritance Mode	Not Specified	Strain of Origin	C57BL/6NCrl
Is Recombinase	false	Is Wild Type	false
Project Collection	IMPC

molecularNote

This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCACACAAACGAGAGTAACCCAA, GTCAAGAACTGACTGCCCCTGGG, which resulted in a Exon Deletion.

mutations:
Intragenic deletion

earliestPublication:
Adams DJ, et al. (2024) Genetic determinants of micronucleus formation in vivo. Nature 627(8002):130-136

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

2 Carried By

0 Driven By

4 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76671918

MouseMine