|  Help  |  About  |  Contact Us

Allele : Bcl7c<em1(IMPC)J> B cell CLL/lymphoma 7C; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6362049 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Bcl7c
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGATCTAAGAAGCCGG and ACTCTGGCAATGAAGACCCG, which resulted in a 1218 bp deletion beginning at Chromosome 7 position 127,707,019 bp and ending after 127,708,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264459 through ENSMUSE00000203727 (exons 2-4) and 868 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation. There is a 26 bp insertion (GGGCCAAGCTTGCTAGAGTGTCAAAA) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories