| Primary Identifier | MGI:6362053 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Smarcc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTCTTTTGGACTAAGCG and AAATGTAATTCCTTAAAAGG, which resulted in a 435 bp deletion beginning at Chromosome 10 position 128,462,848 bp and ending after 128,463,282 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000150241 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 21 amino acids later. |
