|  Help  |  About  |  Contact Us

Allele : 1700030J22Rik<em1(IMPC)J> RIKEN cDNA 1700030J22 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6362055 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  1700030J22Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, ACTTTGCTTTCTAGCACGTG and GTGAGGTCCTTCCCCAGCCA, which resulted in a 926 bp deletion beginning at Chromosome 8 position 116,971,225 bp and ending after 116,972,150 bp (GRCm38/mm10). This mutation deletes 926 bp of ENSMUSE00000425915 (exon 3) and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories