| Primary Identifier | MGI:6362055 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 1700030J22Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, ACTTTGCTTTCTAGCACGTG and GTGAGGTCCTTCCCCAGCCA, which resulted in a 926 bp deletion beginning at Chromosome 8 position 116,971,225 bp and ending after 116,972,150 bp (GRCm38/mm10). This mutation deletes 926 bp of ENSMUSE00000425915 (exon 3) and is predicted to cause a change of amino acid sequence after residue 72 and early truncation 6 amino acids later. |
