|  Help  |  About  |  Contact Us

Allele : Mir216a<em1Uf> microRNA 216a; endonuclease-mediated mutation 1, University of Florida

Primary Identifier  MGI:6361469 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mir216a
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR-targeting of the seed sequence deleted 35 bp (CTGGCAACTGTGAGATGTCCCTATCATTCCTCACAGT).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

1 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories