|  Help  |  About  |  Contact Us

Allele : Rr172<em1Kmm> regulatory region 172; endonuclease-mediated mutation 1, Kenneth Murphy

Primary Identifier  MGI:6368518 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr172
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding sgRNA (gttgtgatctttgaggtaga, gtctccttctgaaatttcagtt, and gaactggcctggggcaggtc) are designed to delete one of two enhancers located in the super-enhancer of the gene +32 kb downstream from the transcriptional start site. The 421 bp deletion results in elimination all four AP1-IRF composite elements (AICEs) in the +32-kb Irf8 enhancer.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Irf8 +32<->,
  • Irf8<em1Kmm>,
  • Irf8<em1Kmm>,
  • Irf8 +32<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

12 Publication categories