| Primary Identifier | MGI:6368518 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr172 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Plasmids encoding sgRNA (gttgtgatctttgaggtaga, gtctccttctgaaatttcagtt, and gaactggcctggggcaggtc) are designed to delete one of two enhancers located in the super-enhancer of the gene +32 kb downstream from the transcriptional start site. The 421 bp deletion results in elimination all four AP1-IRF composite elements (AICEs) in the +32-kb Irf8 enhancer. |