| Primary Identifier | MGI:6368524 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr174 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Plasmids encoding sgRNA (ggtgacatctgtctacggag, and atgcacccaaggcctggctc) are designed to delete one of the enhancers located in the super-enhancer region of the gene -50 kb upstream from the transcriptional start site. The region contains two PU.1 (Spi1)-binding sites. |