|  Help  |  About  |  Contact Us

Allele : Rr174<em1Kmm> regulatory region 174; endonuclease-mediated mutation 1, Kenneth Murphy

Primary Identifier  MGI:6368524 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr174
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding sgRNA (ggtgacatctgtctacggag, and atgcacccaaggcctggctc) are designed to delete one of the enhancers located in the super-enhancer region of the gene -50 kb upstream from the transcriptional start site. The region contains two PU.1 (Spi1)-binding sites.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Irf8 -50<->,
  • Irf8 -50<->,
  • Irf8<em3Kmm>,
  • Irf8<em3Kmm>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories