|  Help  |  About  |  Contact Us

Allele : Eva1a<em1(IMPC)J> eva-1 homolog A, regulator of programmed cell death; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6377661 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eva1a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTCTCTATGTAAGGTCA and GTATGACCTCTGCAGGACTC, which resulted in a 1441 bp deletion beginning at Chromosome 6 position 82,091,741 bp and ending after 82,093,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366139 (exon 3) and 135 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 3 amino acids later. There is a 1 bp (A) insertion at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories