| Primary Identifier | MGI:6377661 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eva1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTCTCTATGTAAGGTCA and GTATGACCTCTGCAGGACTC, which resulted in a 1441 bp deletion beginning at Chromosome 6 position 82,091,741 bp and ending after 82,093,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366139 (exon 3) and 135 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 3 amino acids later. There is a 1 bp (A) insertion at the deletion site. |