| Primary Identifier | MGI:6361950 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Camsap1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCATCTGACCCTAATGGAA and ATGCCATCGGATTAAAGAAG, which resulted in an 826 bp deletion beginning at Chromosome 2 position 25,966,411 bp and ending after 25,967,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001264038 (exon 2) and 563 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 21 amino acids later. There is a single bp (T) insertion at the deletion site. |
