| Primary Identifier | MGI:6385667 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trnp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACGGCGCGGCCAGGGCC and CAGGCGCTGATTCGGCAGCC, which resulted in a 649 bp deletion beginning at Chromosome 4 position 133,497,822 bp and ending after 133,498,470 bp (GRCm38/mm10). This mutation deletes 649 bp from ENSMUSE00000775605 (exon 1) including the start sequence and is predicted to generate a null allele. |