|  Help  |  About  |  Contact Us

Allele : Tsen54<em1(IMPC)J> tRNA splicing endonuclease subunit 54; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6377433 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tsen54
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAAATCCCATCTACGGTGG and GAAAGTGGATGCTTAGACGA, which resulted in a 1008 bp deletion beginning at Chromosome 11 position 115,820,077 bp and ending after 115,821,084 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304729 and ENSMUSE00000109206 (exons 7 and 8) and 280 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 174 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tsen54<->,
  • Tsen54<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories