| Primary Identifier | MGI:6362950 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tcea2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGGTCCCAAATAGCCATT and GGAGGTTTTCAGGCTGCAGG, which resulted in a 459 bp deletion beginning at Chromosome 2 position 181,683,416 bp and ending after 181,683,874 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258127 (exon 3) and 353 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 66 amino acids later. There is an additional 10 bp deletion (GCTGCAGGAG) 22 bp after the 459 bp deletion. |
