| Primary Identifier | MGI:6362956 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp6v1f |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTCATGCAGACACAGAG and GCTGGGAGGGGCCTGCCCAA, which resulted in a 899 bp deletion beginning at Chromosome 6 position 29,469,831 bp and ending after 29,470,729 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261029 (exon 2) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 22 amino acids later. |
