| Primary Identifier | MGI:6363029 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph, Modified regulatory region | Gene | Rr250 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | TALEN-targeting of exon 1 deleted 33 bp (GGCTCATCTGTCAGGGAGAGATAAAACCCACAT) within the Gata2 +9.5 enhancer-like (E-box and GATA motifs) Samd14 enhancer in intron 1. Mass spectrometry for three peptides confirmed a 16-fold reduction in protein expression. |