| Primary Identifier | MGI:6401314 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fahd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCTTGTCAGTTCCCTA and TTGGCTGTGAACTCTATGGG, which resulted in a 1932 bp deletion beginning at Chromosome 17 position 24,848,493 bp and ending after 24,850,424 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343391 (exon 1) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. |
