|  Help  |  About  |  Contact Us

Allele : Skor1<em1(IMPC)J> SKI family transcriptional corepressor 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6385903 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Skor1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTACTTCCTGCATTAAAA and AGATTATCCCAAATCCACTA, which resulted in a 345 bp deletion beginning at Chromosome 9 position 63,143,267 bp and ending after 63,143,611 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000342989 (exon 3) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 768 and early truncation 92 amino acids later. There is a 2 bp insertion (AC) at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories