|  Help  |  About  |  Contact Us

Allele : Ensa<em1(IMPC)J> endosulfine alpha; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6392061 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ensa
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACGACACACCAATAAGCGT and AGGCTCATTACATTGGGAGA, which resulted in a 7358 bp deletion beginning at Chromosome 3 position 95,624,895 bp and ending after 95,632,252 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001346731, ENSMUSE00000251943, and ENSMUSE00000492954 (exons 1, 2 and 3) and 3436 bp of flanking intronic sequence including the splice acceptor and donor and start site. This allele is predicted to generate a null allele. There is a 9 bp AGAAAGCAG insertion at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories