| Primary Identifier | MGI:6392072 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tchh |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGCACTCACGTTTGTTTTG and GACTATATATGAGTTATGAT, which resulted in a 5805 bp deletion beginning at Chromosome 3 position 93,443,307 bp and ending after 93,449,111 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000427035 (exon 2) and 120 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 24 amino acids later. There is a 2 bp insertion (AG) at the deletion site. |
