| Primary Identifier | MGI:6383384 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Scfd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1478 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTTAGTGACTGATCGCAGT targeting the 5' side and CAAAACAACTACGGAGTTAG targeting the 3' side of a critical region. This resulted in a 1621-bp deletion Chr12:51388915-51390535 (GRCm38). |