|  Help  |  About  |  Contact Us

Allele : Zdhhc22<em1(IMPC)J> zinc finger, DHHC-type containing 22; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6401345 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zdhhc22
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCTGAACCTGCCTGCCA and AGCATTGTCCAAGGTTCGAA, which resulted in a 607 bp deletion beginning at Chromosome 12 position 86,988,132 bp and ending after 86,988,738 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001414833 (exon 2) and 67 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories