| Primary Identifier | MGI:6401486 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tbcc |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGCGAGGAGAATATGGA and ACGCTGTCATACTCAAAGGG, which resulted in a 1313 bp deletion beginning at Chromosome 17 position 46,890,571 bp and ending after 46,891,883 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323360 (exon 1) and 149 bp of flanking intronic sequence including the splice acceptor, donor and start site is predicted to generate a null allele. |
