|  Help  |  About  |  Contact Us

Allele : Zfp513<em1(IMPC)J> zinc finger protein 513; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6402263 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Zfp513
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTCTCAAAGCCCATGAGC and ACTGAAGATTCCTTCGACGA, which resulted in a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10). This mutation deletes 108 bp from ENSMUSE00000972866 (exon 2) and is predicted to cause a loss of 36 amino acids after residue 26 and remain in frame for the expected termination.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories