| Primary Identifier | MGI:6402263 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Zfp513 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTCTCAAAGCCCATGAGC and ACTGAAGATTCCTTCGACGA, which resulted in a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10). This mutation deletes 108 bp from ENSMUSE00000972866 (exon 2) and is predicted to cause a loss of 36 amino acids after residue 26 and remain in frame for the expected termination. |