| Primary Identifier | MGI:6402774 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eid2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGCTTCCCGGAGAGAGC and GGCGTTGGGGCCGCGGGCGT, which resulted in a 432 bp deletion beginning at Chromosome 7 position 28,277,795 bp and ending after 28,278,226 bp (GRCm38/mm10). This mutation deletes 432 bp of ENSMUSE00000597783 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 9 amino acids later. |