| Primary Identifier | MGI:6402781 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp6v0b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTTGGGTCTAGTGCACAG and GAGTAAACTGGGAGTCCGGT, which resulted in a 3425 bp deletion beginning at Chromosome 4 position 117,884,089 bp and ending after 117,887,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000761417-ENSMUSE00000737163 (exons 1-8) and 2425 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |
