| Primary Identifier | MGI:6393275 | Allele Type | Endonuclease-mediated |
| Attribute String | Constitutively active, Humanized sequence | Gene | Iqsec2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR/Cas9 technology with an sgRNA (GGCAGCCCTGCGGCTCAGGA) and an ssODN template (CTGAGCT GCGCAGCCGCTCAAAGTTCTTATTCATACGGTACTGTCGAAAGGCTGTCTGGATGGTCCTGGCAACACGGCGGCTCAGGAAGGAGCCCCCATACTTCCTCTCCAGCATTTCCACCTGTCAGAGGAACAAGTTCAGAAAG), alanine codon 350 (GCT) was changed ta a valine codon (GTT) (p.Ala350Val, C>T nucleotide substitution). Additionally, a silent mutation in arginine codon 349 (AGG>CGT) was created to prevent the sgRNA from targeting the modified allele. This mutation mimics one found in some patients suffering from intellectual disability and epilepsy and renders the enzyme constitutively active. |
