| Primary Identifier | MGI:6402725 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp286 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCTTTGATGTCGGATGA and TGACTCCTTGCTCTCAGGTC, which resulted in a 1168 bp deletion beginning at Chromosome 11 position 62,779,722 bp and ending after 62,780,889 bp (GRCm38/mm10). This mutation deletes 1168 bp of ENSMUSE00000355028 (exon 4) and is predicted to cause a change of amino acid sequence after residue 119 and termination 14 amino acids later. |
