| Primary Identifier | MGI:6402744 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prob1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTTTAAAAAGGTGGCAGC and TTTAAGACGCTTTGACCCCG, which resulted in a 4975 bp deletion beginning at Chromosome 18 position 35,650,319 bp and ending after 35,655,293 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001322141 (exon 1) and 87 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. |