| Primary Identifier | MGI:6402757 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Il3ra |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCACTCACCCCAAGTAT and GGTGTAAGATTTGGGAGCAG, which resulted in a 423 bp deletion beginning at Chromosome 14 position 14,348,720 bp and ending after 14,349,142 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000565028 (exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 19 amino acids later. |
