| Primary Identifier | MGI:6393702 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dmtf1l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACTGTGGTCCAGTGGGCA and GAGCTCTGTCTTACTTAGTG, which resulted in a 1381 bp deletion beginning at Chromosome X position 126,814,082 bp and ending after 126,815,466 bp (GRCm38/mm10). This mutation deletes 1381 bp of ENSMUSE00001029817 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. There is a 4 bp insertion (ACCA) at the deletion site. |