| Primary Identifier | MGI:6393527 | Allele Type | Targeted |
| Gene | Clcn2 | Transmission | Germline |
| Strain of Origin | (129X1/SvJ x 129S1/Sv)F1-Kitl<+> | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | An open mutation was generated by inserting an FRT-flanked neomyn cassette between exon 1 and 2, and deleting 24bp (TACACTCAGGAACTCGGGGCCTTT; aa sequence: YTQELGAF) from exon 2. An additional two amino acids (AK to IS; bp change: GCCAAA to ATATCA) deletion created an EcoRV site in exon 2. The modified exon 2 and exon 3 were also floxed to provide the capacity for generating a null allele. Flp-mediatd recombination removed the selection cassette. |
