| Primary Identifier | MGI:6393533 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tigd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGAAATTCTATGACTGTG and GAAGCTTCACGCCCTGTCCC, which resulted in a 1343 bp deletion beginning at Chromosome 19 position 5,891,723 bp and ending after 5,893,065 bp (GRCm38/mm10). This mutation deletes 1343 bp from ENSMUSE00000395106 (exon 2) and is predicted to cause a change of amino acid sequence and early truncation after residue 12. |
