| Primary Identifier | MGI:6393538 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zbed6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGATTGCCAACTACACA and TCTTCTGCCAGGAGAGATTG, which resulted in a 2700 bp deletion beginning at Chromosome 1 position 133,656,861 bp and ending after 133,659,560 bp (GRCm38/mm10). This mutation deletes 2700 bp from ENSMUSE00001073319 (exon 1) and is predicted to cause a change of amino acid sequence after residue 12, deletion of 901 amino acids and a return to frame for the last 67 amino acids and expected termination. |
