| Primary Identifier | MGI:6393546 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pigz |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGACATCCTGGGTGTGC and TTGGGCTGCTTTGTCACAAC, which resulted in a 1520 bp deletion beginning at Chromosome 16 position 31,944,262 bp and ending after 31,945,781 bp (GRCm38/mm10). This mutation deletes 1520 bp from ENSMUSE00000387814 (exon 3) and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 45 amino acids later. |
