|  Help  |  About  |  Contact Us

Allele : Tg(CMV-GFP,-RNAi:Clec16a)KD3Kslr transgene lentiviral insertion KD3, Stephan Kissler

Primary Identifier  MGI:6393884 Allele Type  Transgenic
Attribute String  Knockdown, Reporter Gene  Tg(CMV-GFP,-RNAi:Clec16a)KD3Kslr
Strain of Origin  NOD/MrkTac Is Recombinase  false
Is Wild Type  false
molecularNote  The lentivirus vector introduces a ubiquitously expressed CMV promoter driving a short hairpin RNA targeting Clec16a (CACCTTGTACGTCATTTCTATA in KD3) inserted into the 3' UTR of GFP.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

1 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories