| Primary Identifier | MGI:6394011 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Unkl |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGCAGTTATAGCCCGA and AATGGCTCACGGTTAGCAGT, which resulted in a 299 bp deletion beginning at Chromosome 17 position 25,201,004 bp and ending after 25,201,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001293958 (exon 4) and 165 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 1 amino acids later. |
