| Primary Identifier | MGI:6400549 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tspan7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCACTGGGGTGATCCTGT and TAGTCCATGGATGCTGAAAC, which resulted in a 182 bp deletion beginning at Chromosome X position 10,579,319 bp and ending after 10,579,500 bp (GRCm38/mm10). This mutation deletes 182 bp from ENSMUSE00001242986 (exon 2) and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 11 amino acids later. |
